Somatic Mutation Profiling and Trastuzumab in Breast Cancer
Somatic Mutation Profiling and Trastuzumab in Breast Cancer
The Reporting Recommendations for Tumor Marker Prognostic Studies (REMARK) criteria were followed in this study.
This study is based on formalin-fixed, paraffin-embedded (FFPE) primary breast tumor tissue samples of Finnish women who were aged <66 years and diagnosed with either node-positive or node-negative breast cancer and who participated in the FinHER trial (N = 1010) from 2000 to 2003, a multicenter adjuvant trial sponsored by the Finnish Breast Cancer Group. All women were randomly assigned to receive three cycles of docetaxel or vinorelbine, followed by (in both groups) three cycles of fluorouracil, epirubicin, and cyclophosphamide. The 232 women whose tumors had an amplified HER2/neu gene were further randomly assigned to receive or to not receive nine weekly trastuzumab infusions. The primary end point of the FinHER study, distant disease-free survival (DDFS), has been previously reported to be superior for the docetaxel- and trastuzumab-containing arms. The final median follow-up was 62 months.
The determination of steroid hormone receptor status and HER2 expression by immunohistochemistry (IHC) was required locally and was performed according to the guidelines of each institution during the time of the study. Samples were considered hormone receptor positive if their level of ER and/or progesterone receptor (PR) was ≥10%. All patients with ER- or PR-positive tumors received five years of endocrine therapy, which was tamoxifen when the study commenced, but aromatase inhibitors were permitted midway through the study. Ki67 IHC was assessed in locally by IHC using the Mib-1 monoclonal antibody (Dako, Glostrup, Denmark). When HER2 expression was scored as 2+ or 3+ (on a scale of 0, 1+, 2+, or 3+), the number of copies of the HER2/neu gene was centrally determined by means of chromogenic in situ hybridization in one of two reference laboratories.
Study participants provided written informed consent to allow further research analyses to be carried out on their tumor tissue. The ethical committee of the Helsinki University Central Hospital also approved the current study. Of the 1010 samples, 935 (92.5%) could be retrieved. All samples were reevaluated by one reference pathologist to ensure tumor was present in the tissue sample. Of these samples, 705 (75.4%) were able to have adequate DNA extracted. DNA was extracted from FFPE tumor tissue using a salt precipitation method.
Because few data were available about the mutational landscape of breast cancer at the time of genotyping, we queried the COSMIC (Catalogue of Somatic Mutations in Cancer) database to identify a broad range of genes for hotspot somatic mutation profiling. We ultimately covered 94% of reported PIK3CA mutations (exons 1, 2, 4, 9, 13, 18, 20] reported in COSMIC to be occurring in breast cancer in this study, 12% of TP53 mutations (all cancer types), selected ERBB2, PTEN, AKT1/2 mutations, and known EGFR, BRAF, KRAS, MAP3K1, and CDK4 mutations, as well as a scattering of other "druggable" mutations. In total, 70 mutations in 20 genes were evaluated (Supplementary Table 1, available online).
The samples were genotyped centrally using the Sequenom MassARRAY Assay Design 3.1 with the default parameters. Multiplex polymerase chain reaction was done in 5-µL volume containing 5–10ng of DNA. Samples were considered to be of sufficient quality when genotyping could be performed for >75% of the mutations. A total of 687 samples (68.1% of the original FinHER cohort) were successfully genotyped (2.5% [18 of 705] samples were discarded for this reason). Sixteen samples were genotyped in duplicate and were found to have 100% concordance. Details about the assay and independent validation have been previously published: the Sequenom can detect low-frequency mutant alleles to maximize mutation detection in impure samples (≥5% for the PIK3CA hotspot mutations) with sensitivity and specificity of 90% and 99%, respectively, in FFPE-derived DNA, and 100% concordance with other technologies. In this study, we further confirmed one sample of each positive PIK3CA mutation, as well as a wild-type sample, using Sanger sequencing (except for the rarer G241A, G3019C, and C473T); another 9 samples (both positive and wild type) were confirmed with the Qiagen Rotor-gene Kit. All of these were found to be 100% concordant with the Sequenom results. ERBB2 mutations were also confirmed using Sanger sequencing (primers TCCTGGAAGGCAGGTAGGATCCAG and AGTCTAGGTTTGCGGGAGTCATATCTC).
In this study, a sample was considered to be wild type for a given gene if no mutation was found. Associations between mutations and clinicopathologic characteristics were investigated with χ tests for categorical variables. For the survival analyses, the primary end point was DDFS, which was defined as the time period from the date of random treatment assignment to the date of first cancer recurrence outside the ipsilateral locoregional region or to death, whenever death occurred before distant recurrence. Relapse-free survival (RFS) was defined as the time from the date of random assignment to the date of the local, distant, or contralateral invasive cancer recurrence or death. Overall survival (OS) was defined as the time period from the date of random assignment to the date of death, whenever death occurred before distant recurrence.
Cox proportional hazards regression models were used to test the prognostic value of PIK3CA mutation status (hazard ratios [HRs] and 95% confidence intervals [CIs]) and its possible interaction with trastuzumab treatment (after adding a trastuzumab main effect and a product interaction term) using the Wald test. The Cox models used a separate baseline hazard for chemotherapy type (docetaxel or vinorelbine). Departures from the proportional hazards assumption were assessed based on the Schoenfeld residuals.
All P values were two-sided and a P value of less than .05 was considered statistically significant. The Kaplan-Meier survival curves were calculated (with group differences assessed using the log-rank test). Interaction effects were also displayed using forest plots. No adjustment was planned for multiple testing of the prespecified hypotheses. For this study, breast cancer subtypes were classified using IHC as previously published: luminal (ER-positive and/or progesteron receptor [PgR]–positive, HER2-negative), HER2-positive/overexpressing by (chromogenic in situ hybridization), and triple negative: ER-negative/PgR-negative/HER2-negative. Luminal A and B phenotypes were defined using IHC staining of Ki67-positive cells using a cutoff of less than 14% and greater than 14%, respectively.
Methods
The Reporting Recommendations for Tumor Marker Prognostic Studies (REMARK) criteria were followed in this study.
Patients in the FinHER Study
This study is based on formalin-fixed, paraffin-embedded (FFPE) primary breast tumor tissue samples of Finnish women who were aged <66 years and diagnosed with either node-positive or node-negative breast cancer and who participated in the FinHER trial (N = 1010) from 2000 to 2003, a multicenter adjuvant trial sponsored by the Finnish Breast Cancer Group. All women were randomly assigned to receive three cycles of docetaxel or vinorelbine, followed by (in both groups) three cycles of fluorouracil, epirubicin, and cyclophosphamide. The 232 women whose tumors had an amplified HER2/neu gene were further randomly assigned to receive or to not receive nine weekly trastuzumab infusions. The primary end point of the FinHER study, distant disease-free survival (DDFS), has been previously reported to be superior for the docetaxel- and trastuzumab-containing arms. The final median follow-up was 62 months.
The determination of steroid hormone receptor status and HER2 expression by immunohistochemistry (IHC) was required locally and was performed according to the guidelines of each institution during the time of the study. Samples were considered hormone receptor positive if their level of ER and/or progesterone receptor (PR) was ≥10%. All patients with ER- or PR-positive tumors received five years of endocrine therapy, which was tamoxifen when the study commenced, but aromatase inhibitors were permitted midway through the study. Ki67 IHC was assessed in locally by IHC using the Mib-1 monoclonal antibody (Dako, Glostrup, Denmark). When HER2 expression was scored as 2+ or 3+ (on a scale of 0, 1+, 2+, or 3+), the number of copies of the HER2/neu gene was centrally determined by means of chromogenic in situ hybridization in one of two reference laboratories.
Mutation Testing
Study participants provided written informed consent to allow further research analyses to be carried out on their tumor tissue. The ethical committee of the Helsinki University Central Hospital also approved the current study. Of the 1010 samples, 935 (92.5%) could be retrieved. All samples were reevaluated by one reference pathologist to ensure tumor was present in the tissue sample. Of these samples, 705 (75.4%) were able to have adequate DNA extracted. DNA was extracted from FFPE tumor tissue using a salt precipitation method.
Because few data were available about the mutational landscape of breast cancer at the time of genotyping, we queried the COSMIC (Catalogue of Somatic Mutations in Cancer) database to identify a broad range of genes for hotspot somatic mutation profiling. We ultimately covered 94% of reported PIK3CA mutations (exons 1, 2, 4, 9, 13, 18, 20] reported in COSMIC to be occurring in breast cancer in this study, 12% of TP53 mutations (all cancer types), selected ERBB2, PTEN, AKT1/2 mutations, and known EGFR, BRAF, KRAS, MAP3K1, and CDK4 mutations, as well as a scattering of other "druggable" mutations. In total, 70 mutations in 20 genes were evaluated (Supplementary Table 1, available online).
The samples were genotyped centrally using the Sequenom MassARRAY Assay Design 3.1 with the default parameters. Multiplex polymerase chain reaction was done in 5-µL volume containing 5–10ng of DNA. Samples were considered to be of sufficient quality when genotyping could be performed for >75% of the mutations. A total of 687 samples (68.1% of the original FinHER cohort) were successfully genotyped (2.5% [18 of 705] samples were discarded for this reason). Sixteen samples were genotyped in duplicate and were found to have 100% concordance. Details about the assay and independent validation have been previously published: the Sequenom can detect low-frequency mutant alleles to maximize mutation detection in impure samples (≥5% for the PIK3CA hotspot mutations) with sensitivity and specificity of 90% and 99%, respectively, in FFPE-derived DNA, and 100% concordance with other technologies. In this study, we further confirmed one sample of each positive PIK3CA mutation, as well as a wild-type sample, using Sanger sequencing (except for the rarer G241A, G3019C, and C473T); another 9 samples (both positive and wild type) were confirmed with the Qiagen Rotor-gene Kit. All of these were found to be 100% concordant with the Sequenom results. ERBB2 mutations were also confirmed using Sanger sequencing (primers TCCTGGAAGGCAGGTAGGATCCAG and AGTCTAGGTTTGCGGGAGTCATATCTC).
Statistical Analysis
In this study, a sample was considered to be wild type for a given gene if no mutation was found. Associations between mutations and clinicopathologic characteristics were investigated with χ tests for categorical variables. For the survival analyses, the primary end point was DDFS, which was defined as the time period from the date of random treatment assignment to the date of first cancer recurrence outside the ipsilateral locoregional region or to death, whenever death occurred before distant recurrence. Relapse-free survival (RFS) was defined as the time from the date of random assignment to the date of the local, distant, or contralateral invasive cancer recurrence or death. Overall survival (OS) was defined as the time period from the date of random assignment to the date of death, whenever death occurred before distant recurrence.
Cox proportional hazards regression models were used to test the prognostic value of PIK3CA mutation status (hazard ratios [HRs] and 95% confidence intervals [CIs]) and its possible interaction with trastuzumab treatment (after adding a trastuzumab main effect and a product interaction term) using the Wald test. The Cox models used a separate baseline hazard for chemotherapy type (docetaxel or vinorelbine). Departures from the proportional hazards assumption were assessed based on the Schoenfeld residuals.
All P values were two-sided and a P value of less than .05 was considered statistically significant. The Kaplan-Meier survival curves were calculated (with group differences assessed using the log-rank test). Interaction effects were also displayed using forest plots. No adjustment was planned for multiple testing of the prespecified hypotheses. For this study, breast cancer subtypes were classified using IHC as previously published: luminal (ER-positive and/or progesteron receptor [PgR]–positive, HER2-negative), HER2-positive/overexpressing by (chromogenic in situ hybridization), and triple negative: ER-negative/PgR-negative/HER2-negative. Luminal A and B phenotypes were defined using IHC staining of Ki67-positive cells using a cutoff of less than 14% and greater than 14%, respectively.
Source...